ID: 1033391163_1033391165

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1033391163 1033391165
Species Human (GRCh38) Human (GRCh38)
Location 7:140928799-140928821 7:140928823-140928845
Sequence CCAGCATTTCTATCTCGAATCTT CATTCTATTTTAATGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!