ID: 1033410630_1033410635

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1033410630 1033410635
Species Human (GRCh38) Human (GRCh38)
Location 7:141114577-141114599 7:141114620-141114642
Sequence CCTTCTGCCCTTTGGGCAGGTGA GTCTCTTTCCAAAGTCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 253} {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!