|
Left Crispr |
Right Crispr |
| Crispr ID |
1033463013 |
1033463026 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:141564525-141564547
|
7:141564568-141564590
|
| Sequence |
CCTTCCATTGGGCCCCTCCCATG |
CTGTAGTTCAGGATGAGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 83, 3: 796, 4: 1714} |
{0: 1, 1: 1, 2: 85, 3: 1311, 4: 6610} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|