ID: 1033477196_1033477212

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1033477196 1033477212
Species Human (GRCh38) Human (GRCh38)
Location 7:141702218-141702240 7:141702260-141702282
Sequence CCTGGCCGCGCCAACGCCGCCGC TGCCCGGGGCCCCGCCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 77, 4: 485} {0: 1, 1: 0, 2: 1, 3: 37, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!