ID: 1033518319_1033518326

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1033518319 1033518326
Species Human (GRCh38) Human (GRCh38)
Location 7:142131718-142131740 7:142131750-142131772
Sequence CCCTCTCTGCAGGAATCTCTGGA CAGGCTAATTTTTATTTGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 284} {0: 1, 1: 0, 2: 3, 3: 50, 4: 842}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!