ID: 1033518444_1033518452

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1033518444 1033518452
Species Human (GRCh38) Human (GRCh38)
Location 7:142134046-142134068 7:142134097-142134119
Sequence CCAGTGCCAATGTGTATGGGCTG ACAATATGACCTGGAAGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117} {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!