ID: 1033532570_1033532575

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1033532570 1033532575
Species Human (GRCh38) Human (GRCh38)
Location 7:142280003-142280025 7:142280056-142280078
Sequence CCAGGACTGGAGTCAAATCATTT GGTGAAGCAAGTATGCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!