ID: 1033582915_1033582923

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1033582915 1033582923
Species Human (GRCh38) Human (GRCh38)
Location 7:142752861-142752883 7:142752889-142752911
Sequence CCCCCAGGGTGATTCTGGTGGCC GTCTGCAATGGACAGCTCCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 195} {0: 1, 1: 2, 2: 2, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!