ID: 1033585941_1033585951

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1033585941 1033585951
Species Human (GRCh38) Human (GRCh38)
Location 7:142774349-142774371 7:142774390-142774412
Sequence CCCCCAGGGTGATTCTGGTGGCC AGCTCCAAGGAATTGTCTCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 195} {0: 1, 1: 3, 2: 0, 3: 13, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!