ID: 1033585941_1033585955

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1033585941 1033585955
Species Human (GRCh38) Human (GRCh38)
Location 7:142774349-142774371 7:142774398-142774420
Sequence CCCCCAGGGTGATTCTGGTGGCC GGAATTGTCTCCTGGGGCTATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 195} {0: 1, 1: 2, 2: 2, 3: 18, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!