ID: 1033599176_1033599189

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1033599176 1033599189
Species Human (GRCh38) Human (GRCh38)
Location 7:142876699-142876721 7:142876736-142876758
Sequence CCTGCAGCATCCCAGCTCCCCTC TACCCAGGGAGTCCTGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 611} {0: 1, 1: 0, 2: 1, 3: 22, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!