ID: 1033600128_1033600138

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1033600128 1033600138
Species Human (GRCh38) Human (GRCh38)
Location 7:142883434-142883456 7:142883481-142883503
Sequence CCCTTTGGAACAAATTCAACTTC GGGCCTGCCCCATTCATAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 250} {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!