ID: 1033629451_1033629457

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1033629451 1033629457
Species Human (GRCh38) Human (GRCh38)
Location 7:143142300-143142322 7:143142329-143142351
Sequence CCACCTCACCTGGCTAATTTTTT CTTTTTGTAGAGATTGGGCAGGG
Strand - +
Off-target summary {0: 119, 1: 10443, 2: 56689, 3: 130269, 4: 193688} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!