ID: 1033629452_1033629457

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1033629452 1033629457
Species Human (GRCh38) Human (GRCh38)
Location 7:143142303-143142325 7:143142329-143142351
Sequence CCTCACCTGGCTAATTTTTTTAA CTTTTTGTAGAGATTGGGCAGGG
Strand - +
Off-target summary {0: 109, 1: 1483, 2: 30513, 3: 85433, 4: 176135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!