ID: 1033641734_1033641743

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1033641734 1033641743
Species Human (GRCh38) Human (GRCh38)
Location 7:143268317-143268339 7:143268361-143268383
Sequence CCCGTCTCTACTAAAAATATAAA CCTCAGTGGGAGGCTGAGGCAGG
Strand - +
Off-target summary {0: 6802, 1: 180538, 2: 221127, 3: 132961, 4: 86030} {0: 1, 1: 7, 2: 148, 3: 6165, 4: 173273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!