ID: 1033647592_1033647597

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1033647592 1033647597
Species Human (GRCh38) Human (GRCh38)
Location 7:143317183-143317205 7:143317215-143317237
Sequence CCTCCAAAGAATGCAGAGAATAA GAATTTGTCTAGAGGGCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 375} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!