ID: 1033651344_1033651353

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1033651344 1033651353
Species Human (GRCh38) Human (GRCh38)
Location 7:143346165-143346187 7:143346194-143346216
Sequence CCTCTACTACTGCCCCTCTGTCC GAGCCCAATGGGCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 302} {0: 1, 1: 0, 2: 1, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!