ID: 1033658845_1033658854

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1033658845 1033658854
Species Human (GRCh38) Human (GRCh38)
Location 7:143390379-143390401 7:143390406-143390428
Sequence CCTCTTGCAGGAAGGTCCTAGTG ACTGGAAGTAGGATAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 109} {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!