ID: 1033663016_1033663024

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1033663016 1033663024
Species Human (GRCh38) Human (GRCh38)
Location 7:143416141-143416163 7:143416180-143416202
Sequence CCCCGGGAGCACAGCGATAGCTT TGTACTGGTTGGAGCTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!