ID: 1033685690_1033685693

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1033685690 1033685693
Species Human (GRCh38) Human (GRCh38)
Location 7:143639612-143639634 7:143639639-143639661
Sequence CCATGGTGGAGTTGATGGCGTGA GCCTTTTCTCTCCCGCCTTGTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 151} {0: 3, 1: 0, 2: 5, 3: 18, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!