ID: 1033688172_1033688181

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1033688172 1033688181
Species Human (GRCh38) Human (GRCh38)
Location 7:143710090-143710112 7:143710140-143710162
Sequence CCCCCTTGTTGCAGCTTGGGTTA ACATGTGTGGGAGGTTTGTGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 2, 4: 120} {0: 3, 1: 0, 2: 2, 3: 21, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!