ID: 1033690050_1033690057

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1033690050 1033690057
Species Human (GRCh38) Human (GRCh38)
Location 7:143727676-143727698 7:143727711-143727733
Sequence CCACAAGGCGGGAGAGAAAAGGC TCAACTCCACCATGGGGCTTTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 5, 3: 18, 4: 246} {0: 3, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!