ID: 1033703412_1033703418

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033703412 1033703418
Species Human (GRCh38) Human (GRCh38)
Location 7:143861664-143861686 7:143861685-143861707
Sequence CCTATCTCATGGTGGTGATTCTG TGGCATTTGGAATGGGGCAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 148} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!