ID: 1033706842_1033706847

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033706842 1033706847
Species Human (GRCh38) Human (GRCh38)
Location 7:143897281-143897303 7:143897302-143897324
Sequence CCTTCCTCCTCATCCTTAGCCTA TACTCAATGTGAAGATGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 111, 4: 624} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!