ID: 1033735648_1033735655

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1033735648 1033735655
Species Human (GRCh38) Human (GRCh38)
Location 7:144218882-144218904 7:144218910-144218932
Sequence CCTGGGTGGAAGTGTGGGTGGCC AGCTGCATTTCCATGGTGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 31, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!