ID: 1033747395_1033747405

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1033747395 1033747405
Species Human (GRCh38) Human (GRCh38)
Location 7:144332050-144332072 7:144332088-144332110
Sequence CCCAGAGCTCCCACCACCATGGA GCCACCCACACTTCCACCCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 34, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!