ID: 1033747399_1033747410

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1033747399 1033747410
Species Human (GRCh38) Human (GRCh38)
Location 7:144332063-144332085 7:144332099-144332121
Sequence CCACCATGGAAATGCAGCTCCCA TTCCACCCAGGGGCAGCTCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 19, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!