ID: 1033750230_1033750246

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1033750230 1033750246
Species Human (GRCh38) Human (GRCh38)
Location 7:144355394-144355416 7:144355443-144355465
Sequence CCGCGGGTGGGGCGGCCGGGCCT GGCCGGCGCCGGGACCTGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 23, 4: 196} {0: 3, 1: 0, 2: 1, 3: 31, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!