ID: 1033756929_1033756941

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1033756929 1033756941
Species Human (GRCh38) Human (GRCh38)
Location 7:144403696-144403718 7:144403738-144403760
Sequence CCTGGACTCCCGCCGCCGCGGCC CGGCCTAATGAAGCCTCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 500} {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!