ID: 1033756929_1033756945

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1033756929 1033756945
Species Human (GRCh38) Human (GRCh38)
Location 7:144403696-144403718 7:144403746-144403768
Sequence CCTGGACTCCCGCCGCCGCGGCC TGAAGCCTCGCCGGGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 500} {0: 1, 1: 0, 2: 1, 3: 12, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!