ID: 1033845927_1033845929

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1033845927 1033845929
Species Human (GRCh38) Human (GRCh38)
Location 7:145432111-145432133 7:145432140-145432162
Sequence CCTAATTTCAATATTGTTGCATC AATAAGAAGTCCTGAGGAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 29, 3: 173, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!