ID: 1033907351_1033907355

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1033907351 1033907355
Species Human (GRCh38) Human (GRCh38)
Location 7:146221937-146221959 7:146221977-146221999
Sequence CCTCAGTGCCTAGCATGGTAGCA AAGTGTTTGTGAAAGGAAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 42, 4: 374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!