ID: 1033947558_1033947564

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1033947558 1033947564
Species Human (GRCh38) Human (GRCh38)
Location 7:146740708-146740730 7:146740750-146740772
Sequence CCAGAATCCCTGGACAGCTGTGA AGCCTGGAACCCACTACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 197} {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!