ID: 1033956251_1033956256

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1033956251 1033956256
Species Human (GRCh38) Human (GRCh38)
Location 7:146852059-146852081 7:146852099-146852121
Sequence CCTCATATTAACTATACATGTAA ATGGTAACATTCTGAGACATTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 49, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!