ID: 1033965872_1033965873

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1033965872 1033965873
Species Human (GRCh38) Human (GRCh38)
Location 7:146974596-146974618 7:146974641-146974663
Sequence CCAAATTGGAAATTAGTAATCTT TAGTAAAAGCATATTGATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!