ID: 1033967108_1033967115

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1033967108 1033967115
Species Human (GRCh38) Human (GRCh38)
Location 7:146989359-146989381 7:146989393-146989415
Sequence CCACTTTGGCCAGTCACTGGATA AGGAAACAAGTAGTAGATGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 146} {0: 1, 1: 0, 2: 3, 3: 25, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!