ID: 1033974074_1033974081

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1033974074 1033974081
Species Human (GRCh38) Human (GRCh38)
Location 7:147078427-147078449 7:147078473-147078495
Sequence CCATCTGGAGCCCCGATGACTGT AAGCTGTTACTGATTAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!