ID: 1033999513_1033999515

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1033999513 1033999515
Species Human (GRCh38) Human (GRCh38)
Location 7:147394649-147394671 7:147394692-147394714
Sequence CCATAATGGGTGTTTCTATCCAA AAGATATAATAGTAATTGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93} {0: 1, 1: 0, 2: 0, 3: 32, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!