ID: 1033999513_1033999516

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1033999513 1033999516
Species Human (GRCh38) Human (GRCh38)
Location 7:147394649-147394671 7:147394695-147394717
Sequence CCATAATGGGTGTTTCTATCCAA ATATAATAGTAATTGATTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93} {0: 1, 1: 0, 2: 2, 3: 24, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!