ID: 1034010135_1034010139

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1034010135 1034010139
Species Human (GRCh38) Human (GRCh38)
Location 7:147520853-147520875 7:147520877-147520899
Sequence CCGTAGACCCTGTCCTCTGTCAG CAGTCACTTCATTTACCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202} {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!