ID: 1034025876_1034025878

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1034025876 1034025878
Species Human (GRCh38) Human (GRCh38)
Location 7:147703205-147703227 7:147703234-147703256
Sequence CCCAGATCACTCTAATTAGAACA AAACTGACAACTAAAGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184} {0: 1, 1: 0, 2: 0, 3: 27, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!