ID: 1034029424_1034029434

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1034029424 1034029434
Species Human (GRCh38) Human (GRCh38)
Location 7:147743813-147743835 7:147743853-147743875
Sequence CCCAGCTCCGTGGCTTCTCCCCA TGCCATGGTGATGGCTACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!