ID: 1034054081_1034054093

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1034054081 1034054093
Species Human (GRCh38) Human (GRCh38)
Location 7:148016169-148016191 7:148016207-148016229
Sequence CCTGCCAATCTCCACGTCCTTTG GACATGCCCATCCCCTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 143} {0: 1, 1: 1, 2: 2, 3: 22, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!