ID: 1034060833_1034060837

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1034060833 1034060837
Species Human (GRCh38) Human (GRCh38)
Location 7:148087096-148087118 7:148087136-148087158
Sequence CCTCAGAACACGTGCCCGAACTA ATTGATTTCTTTCTACAGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!