ID: 1034064987_1034064990

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1034064987 1034064990
Species Human (GRCh38) Human (GRCh38)
Location 7:148127504-148127526 7:148127527-148127549
Sequence CCACAAAAATGTGCAGGCAGCGG CCTAATGTCCTACTAATCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!