ID: 1034079278_1034079282

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1034079278 1034079282
Species Human (GRCh38) Human (GRCh38)
Location 7:148261593-148261615 7:148261608-148261630
Sequence CCTGCTTAGCCAAGCTGGAGCTG TGGAGCTGGTCCGGAATTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 188} {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!