|
Left Crispr |
Right Crispr |
| Crispr ID |
1034081981 |
1034081990 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:148287665-148287687
|
7:148287703-148287725
|
| Sequence |
CCAAGGTCCAGGGGCCACTTCTG |
CTGTGTCATGGCATGGTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 37, 3: 154, 4: 461} |
{0: 1, 1: 3, 2: 96, 3: 614, 4: 1604} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|