ID: 1034089877_1034089881

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034089877 1034089881
Species Human (GRCh38) Human (GRCh38)
Location 7:148353886-148353908 7:148353935-148353957
Sequence CCATTAATAAGTTTTTGGTGTCT TCATTTGAGTACACTCAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 354} {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!