ID: 1034091985_1034091991 |
View in Genome Browser |
Spacer: 6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1034091985 | 1034091991 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:148372084-148372106 | 7:148372113-148372135 |
| Sequence | CCCAGCTACTCGGGAGGCTGAGG | CATCGCGTGAACCTGGGAGTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 3, 2: 439, 3: 26484, 4: 97651} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||