ID: 1034091987_1034091991

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1034091987 1034091991
Species Human (GRCh38) Human (GRCh38)
Location 7:148372085-148372107 7:148372113-148372135
Sequence CCAGCTACTCGGGAGGCTGAGGC CATCGCGTGAACCTGGGAGTTGG
Strand - +
Off-target summary {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} {0: 1, 1: 3, 2: 439, 3: 26484, 4: 97651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!